Product Information
- Product Type
- cDNA
- Antigen Species
- Human
- NCBI Accession No.
- NP_003087.1
- Alternative names
- Sm-G, SMG
- RNA Reference Number
- NM_003096.2
- OMIM Number
- 603542
- Chromosome Location
- 2p13.3
Product Specification
- Formulation
- Lyophilized
- Storage
- Store the plasmid at -20C.
- cDNA size
- 231bp
- Preparation before usage
- 1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
- Vector description:
- This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
- General Description
- Core component of the spliceosomal U1, U2, U4 and U5 small nuclear ribonucleoproteins (snRNPs), the building blocks of the spliceosome. Thereby, plays an important role in the splicing of cellular pre-mRNAs. Most spliceosomal snRNPs contain a common set of Sm proteins SNRPB, SNRPD1, SNRPD2, SNRPD3, SNRPE, SNRPF and SNRPG that assemble in an heptameric protein ring on the Sm site of the small nuclear RNA to form the core snRNP. Appears to function in the U7 snRNP complex that is involved in histone 3-end processing.
Data
- Nucleotide Sequence:
ATGAGCAAAGCTCACCCTCCCGAGTTGAAAAAATTTATGGACAAGAAGTTATCATTGAAATTAAATGGTGGCAGACATGTCCAAGGAATATTGCGGGGATTTGATCCCTTTATGAACCTTGTGATAGATGAATGTGTGGAGATGGCGACTAGTGGACAACAGAACAATATTGGAATGGTGGTAATACGAGGAAATAGTATCATCATGTTAGAAGCCTTGGAACGAGTATAA - Translation Sequence:
MSKAHPPELK KFMDKKLSLK LNGGRHVQGI LRGFDPFMNL VIDECVEMAT SGQQNNIGMVVIRGNSIIML EALERV
Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.