DPPA3 cDNA

Cat No.
ATGD0288

Size

QTY

List Price

10ug

USD 99


USD 0



Product Information

Product Type
cDNA
Antigen Species
Human
NCBI Accession No.
NP_954980.1
Alternative names
STELLA
RNA Reference Number
NM_199286.3
OMIM Number
608408
Chromosome Location
12p13.31

Product Specification

Formulation
Lyophilized
Storage
Store the plasmid at -20C.
cDNA size
480bp
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
Vector description:
This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
General Description
DPPA3 encodes a protein that in mice may function as a maternal factor during the preimplantation stage of development. In mice, this gene may play a role in transcriptional repression, cell division, and maintenance of cell pluripotentiality. In humans, related intronless loci are located on chromosomes 14 and X.

Data

  1. Nucleotide Sequence:
    ATGGACCCATCACAGTTTAATCCAACCTACATCCCAGGGTCTCCACAAATGCTCACCGAAGAAAATTCCCGGGACGATTCAGGGGCCTCTCAAATCTCCTCCGAGACGTTGATAAAGAACCTTAGTAACTTGACTATCAACGCTAGTAGCGAATCTGTTTCCCCTCTATCGGAAGCTTTACTCCGTCGAGAGTCTGTAGGAGCAGCAGTCCTCAGGGAAATCGAAGATGAGTGGCTTTACAGCAGGAGAGGAGTAAGAACATTGCTGTCTGTGCAGAGAGAAAAGATGGCAAGATTGAGATACATGTTACTCGGCGGAGTTCGTACGCATGAAAGAAGACCAACAAACAAGGAGCCTAAGGGAGTTAAGAAGGAATCAAGACCATTCAAATGTCCCTGCAGTTTCTGCGTGTCTAATGGATGGGATCCTTCTGAGAATGCTAGAATAGGGAATCAAGACACCAAGCCACTTCAGCCATAA
  2. Translation Sequence:
    MDPSQFNPTY IPGSPQMLTE ENSRDDSGAS QISSETLIKN LSNLTINASS ESVSPLSEAL LRRESVGAAV LREIEDEWLY SRRGVRTLLS VQREKMARLR YMLLGGVRTH ERRPTNKEPK GVKKESRPFK CPCSFCVSNG WDPSENARIG NQDTKPLQP

Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.