GCSAM cDNA

Cat No.
ATGD0293

Size

QTY

List Price

10ug

USD 99


USD 0



Product Information

Product Type
cDNA
Antigen Species
Human
NCBI Accession No.
NP_689998.1
Alternative names
GCAT2, GCET2, HGAL
RNA Reference Number
NM_152785.4
OMIM Number
607792
Chromosome Location
3q13.2

Product Specification

Formulation
Lyophilized
Storage
Store the plasmid at -20C.
cDNA size
537bp
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
Vector description:
This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
General Description
GCSAM encodes a protein which may function in signal transduction pathways and whose expression is elevated in germinal cell lymphomas. It contains a putative PDZ-interacting domain, an immunoreceptor tyrosine-based activation motif (ITAM), and two putative SH2 binding sites. In B cells, its expression is specifically induced by interleukin-4. Alternative splicing results in multiple transcript variants encoding different isoforms.

Data

  1. Nucleotide Sequence:
    ATGGGAAATTCTCTGCTGAGAGAAAACAGGCGGCAGCAGAACACTCAAGAGATGCCTTGGAATGTGAGAATGCAAAGCCCCAAACAGAGAACATCCAGATGCTGGGATCACCATATCGCTGAAGGGTGTTTCTGCCTTCCATGGAAAAAAATACTCATTTTTGAAAAGAGGCAAGATTCCCAAAACGAAAATGAAAGAATGTCATCTACTCCCATCCAGGACAATGTTGACCAGACCTACTCAGAGGAGCTGTGCTATACCCTCATCAATCATCGGGTTCTCTGTACAAGGCCATCAGGGAACTCTGCTGAAGAGTACTATGAGAATGTTCCCTGCAAAGCTGAGAGACCCAGAGAGTCCTTGGGAGGAACTGAGACTGAGTATTCACTTCTACATATGCCTTCTACAGACCCCAGGCATGCCCGATCCCCAGAAGATGAATATGAACTTCTCATGCCTCACAGAATCTCCTCTCACTTTCTGCAACAGCCACGTCCACTTATGGCCCCTTCTGAGACTCAGTTTTCCCATTTATAG
  2. Translation Sequence:
    MGNSLLRENR RQQNTQEMPW NVRMQSPKQR TSRCWDHHIA EGCFCLPWKK ILIFEKRQDS QNENERMSST PIQDNVDQTY SEELCYTLIN HRVLCTRPSG NSAEEYYENV PCKAERPRES LGGTETEYSL LHMPSTDPRH ARSPEDEYEL LMPHRISSHF LQQPRPLMAP SETQFSHL

Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.