GINS4 cDNA

Cat No.
ATGD0295

Size

QTY

List Price

10ug

USD 99


USD 0



Product Information

Product Type
cDNA
Antigen Species
Human
NCBI Accession No.
NP_115712.1
Alternative names
SLD5
RNA Reference Number
NM_032336.2
OMIM Number
610611
Chromosome Location
8p11.21

Product Specification

Formulation
Lyophilized
Storage
Store the plasmid at -20C.
cDNA size
672bp
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
Vector description:
This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
General Description

Data

  1. Nucleotide Sequence:
    ATGACCGAAGAAGTGGATTTCCTGGGACAGGACTCTGATGGGGGTAGTGAGGAAGTGGTCCTAACTCCTGCAGAGCTCATTGAAAGATTGGAGCAGGCCTGGATGAATGAAAAGTTTGCCCCTGAGCTGCTGGAGAGCAAGCCTGAGATTGTAGAATGTGTCATGGAACAGCTGGAGCACATGGAAGAAAATCTCAGGAGAGCCAAAAGGGAGGACCTGAAGGTCAGCATCCACCAAATGGAGATGGAGAGGATCCGCTACGTCCTCAGCAGCTACTTGCGGTGTCGCCTCATGAAGATAGAGAAGTTTTTCCCTCATGTCCTTGAGAAGGAAAAAACACGTCCTGAGGGGGAGCCTTCCAGCCTCTCGCCGGAAGAGTTGGCCTTTGCCAGAGAGTTCATGGCGAACACAGAGTCCTATCTGAAAAATGTCGCCTTGAAGCACATGCCCCCTAACTTACAGAAGGTGGACCTCTTTCGGGCAGTTCCCAAACCAGATCTAGATTCTTACGTGTTTCTGAGAGTGAGAGAACGACAAGAAAACATACTGGTAGAACCAGACACAGATGAGCAGAGGGACTACGTGATTGACCTGGAGAAGGGCTCACAGCACTTGATCCGATACAAAACCATTGCACCTCTGGTTGCATCTGGAGCTGTCCAGCTAATTTAA
  2. Translation Sequence:
    MTEEVDFLGQ DSDGGSEEVV LTPAELIERL EQAWMNEKFA PELLESKPEI VECVMEQLEH MEENLRRAKR EDLKVSIHQM EMERIRYVLS SYLRCRLMKI EKFFPHVLEK EKTRPEGEPS SLSPEELAFA REFMANTESY LKNVALKHMP PNLQKVDLFR AVPKPDLDSY VFLRVRERQE NILVEPDTDE QRDYVIDLEK GSQHLIRYKT IAPLVASGAV QLI

Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.