PPP1R2 cDNA

Cat No.
ATGD0333

Size

QTY

List Price

10ug

USD 99


USD 0



Product Information

Product Type
cDNA
Antigen Species
Human
NCBI Accession No.
NP_006232.1
Alternative names
IPP-2, IPP2
RNA Reference Number
NM_006241.7
OMIM Number
601792
Chromosome Location
3q29

Product Specification

Formulation
Lyophilized
Storage
Store the plasmid at -20C.
cDNA size
618bp
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
Vector description:
This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
General Description
PPP1R2 is an inhibitor of protein-phosphatase 1 and forms heterodimer with PP1. Phosphorylation on Thr-73 by GSK3 activates PP1 by dissociating the PP1-PPP1R2 complex. Phosphorylation on Ser-44 by ATM activates PP1 by dissociating the PP1-PPP1R2 complex.

Data

  1. Nucleotide Sequence:
    ATGGCGGCCTCGACGGCCTCGCACCGGCCCATCAAGGGGATCTTGAAGAACAAGACCTCTACGACTTCCTCTATGGTGGCGTCGGCCGAACAGCCCCGCGGGAATGTCGACGAGGAGCTGAGCAAAAAATCCCAGAAGTGGGATGAAATGAACATCTTGGCGACGTATCATCCAGCAGACAAAGACTATGGTTTAATGAAAATAGATGAACCAAGCACTCCTTACCATAGTATGATGGGGGATGATGAAGATGCCTGTAGTGACACCGAGGCCACTGAAGCCATGGCGCCAGACATCTTAGCCAGGAAATTAGCTGCAGCTGAAGGCTTGGAGCCAAAGTATCGGATTCAGGAACAAGAAAGCAGTGGAGAGGAGGATAGTGACCTCTCACCTGAAGAACGAGAAAAAAAGCGACAATTTGAAATGAAAAGGAAGCTTCACTACAATGAAGGACTCAATATCAAACTAGCCAGACAATTAATTTCAAAAGACCTACATGATGATGATGAAGATGAAGAAATGTTAGAGACTGCAGATGGAGAAAGCATGAATACGGAAGAATCAAATCAAGGATCTACTCCAAGTGACCAACAGCAAAACAAATTACGAAGTTCATAG
  2. Translation Sequence:
    MAASTASHRP IKGILKNKTS TTSSMVASAE QPRGNVDEEL SKKSQKWDEM NILATYHPAD KDYGLMKIDE PSTPYHSMMG DDEDACSDTE ATEAMAPDIL ARKLAAAEGL EPKYRIQEQE SSGEEDSDLS PEEREKKRQF EMKRKLHYNE GLNIKLARQL ISKDLHDDDE DEEMLETADG ESMNTEESNQ GSTPSDQQQN KLRSS

Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.