MAFF cDNA

Cat No.
ATGD0423

Size

QTY

List Price

10ug

USD 99


USD 0



Product Information

Product Type
cDNA
Antigen Species
Human
NCBI Accession No.
NP_001155045.1
Alternative names
hMafF, U-MAF
RNA Reference Number
NM_001161573.1
OMIM Number
604877
Chromosome Location
22q13.1

Product Specification

Formulation
Lyophilized
Storage
Store the plasmid at -20C.
cDNA size
495bp
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
Vector description:
This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
General Description
MAFF is a basic leucine zipper (bZIP) transcription factor that lacks a transactivation domain. It is known to bind the US-2 DNA element in the promoter of the oxytocin receptor (OTR) gene and most likely heterodimerizes with other leucine zipper-containing proteins to enhance expression of the OTR gene during term pregnancy. Multiple transcript variants encoding two different isoforms have been found for this gene.

Data

  1. Nucleotide Sequence:
    ATGTCTGTGGATCCCCTATCCAGCAAAGCTCTAAAGATCAAGCGAGAGCTGAGCGAGAACACGCCGCACCTGTCGGACGAGGCGCTGATGGGGCTGTCGGTGCGCGAGCTGAACCGGCATCTGCGCGGGCTCTCCGCCGAGGAGGTGACACGGCTCAAGCAGCGGCGCCGCACACTCAAAAACCGTGGCTACGCCGCCAGCTGCCGCGTGAAGCGCGTGTGCCAGAAGGAGGAGCTGCAGAAGCAGAAGTCGGAGCTGGAGCGCGAGGTGGACAAGCTGGCGCGCGAGAACGCCGCCATGCGCCTGGAGCTCGACGCGCTGCGCGGCAAGTGCGAGGCGCTGCAGGGCTTCGCGCGCTCCGTGGCCGCCGCCCGCGGGCCCGCCACGCTCGTGGCGCCGGCCAGCGTCATCACCATCGTCAAGTCCACCCCGGGCTCGGGGTCTGGCCCCGCCCACGGCCCGGACCCCGCCCACGGCCCGGCCTCCTGCTCCTAG
  2. Translation Sequence:
    MSVDPLSSKA LKIKRELSEN TPHLSDEALM GLSVRELNRH LRGLSAEEVT RLKQRRRTLK NRGYAASCRV KRVCQKEELQ KQKSELEREV DKLARENAAM RLELDALRGK CEALQGFARS VAAARGPATL VAPASVITIV KSTPGSGSGP AHGPDPAHGP ASCS

Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.