U2AF1L4 cDNA

Cat No.
ATGD0449

Size

QTY

List Price

10ug

USD 99


USD 0



Product Information

Product Type
cDNA
Antigen Species
Human
NCBI Accession No.
NP_001035515.1
Alternative names
U2AF1-RS3, U2AF1L3, U2AF1L3V1, U2AF1RS3, U2af26
RNA Reference Number
NM_001040425.2
OMIM Number
601080
Chromosome Location
19q13.12

Product Specification

Formulation
Lyophilized
Storage
Store the plasmid at -20C.
cDNA size
546bp
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
Vector description:
This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
General Description
U2AF1L4 is a RNA-binding protein that function as a pre-mRNA splicing factor. It plays a critical role in both constitutive and enhancer-dependent splicing by mediating protein-protein interactions and protein-RNA interactions required for accurate 3-splice site selection. U2AF1L4 acts by enhancing the binding of U2AF2 to weak pyrimidine tracts and also participates in the regulation of alternative pre-mRNA splicing.

Data

  1. Nucleotide Sequence:
    ATGGCTGAATATTTAGCTTCGATATTCGGGACTGAGAAGGACAAGGTTAACTGCTCTTTTTACTTTAAGATCGGGGTCTGCCGGCACGGGGACCGGTGCTCCCGGCTTCACAACAAGCCGACATTCAGCCAGGAGGTGTTCACAGAACTGCAGGAGAAGTATGGGGAGATTGAAGAGATGAATGTGTGCGACAACCTTGGGGACCACCTCGTGGGCAACGTCTATGTCAAGTTCCGGAGGGAGGAGGATGGAGAGCGGGCCGTGGCTGAACTCAGTAACCGCTGGTTCAACGGGCAGGCTGTGCACGGTGAGCTGTCTCCTGTCACTGACTTCCGGGAGTCATGCTGTCGCCAGTATGAGATGGGGGAATGTACCCGAGGTGGCTTCTGCAACTTCATGCATCTGCGGCCCATTTCCCAGAACCTCCAGAGGCAGCTCTATGGGCGGGGACCCAGGCGCAGGTCACCCCCGAGGTTCCATACTGGCCACCATCCCCGAGAGAGGAACCATCGGTGTTCCCCTGATCACTGGCATGGCCGCTTCTGA
  2. Translation Sequence:
    MAEYLASIFG TEKDKVNCSF YFKIGVCRHG DRCSRLHNKP TFSQEVFTEL QEKYGEIEEMNVCDNLGDHL VGNVYVKFRR EEDGERAVAE LSNRWFNGQA VHGELSPVTD FRESCCRQYEMGECTRGGFC NFMHLRPISQ NLQRQLYGRG PRRRSPPRFH TGHHPRERNH RCSPDHWHGRF

Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.