Product Information
- Product Type
- cDNA
- Antigen Species
- Human
- NCBI Accession No.
- NP_001019979.1
- Alternative names
- BCL7
- RNA Reference Number
- NM_001024808.1
- OMIM Number
- 601406
- Chromosome Location
- 12q24.13
Product Specification
- Formulation
- Lyophilized
- Storage
- Store the plasmid at -20C.
- cDNA size
- 633bp
- Preparation before usage
- 1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
- Vector description:
- This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
- General Description
- BCL7A is directly involved, with Myc and IgH, in a three-way gene translocation in a Burkitt lymphoma cell line. As a result of the gene translocation, the N-terminal region of the gene product is disrupted, which is thought to be related to the pathogenesis of a subset of high-grade B cell non-Hodgkin lymphoma. The N-terminal segment involved in the translocation includes the region that shares a strong sequence similarity with those of BCL7B and BCL7C. Two transcript variants encoding different isoforms have been found for this gene.
Data
- Nucleotide Sequence:
ATGTCGGGCAGGTCGGTTCGAGCCGAGACGAGGAGCCGGGCCAAAGATGATATCAAGAGGGTCATGGCGGCGATCGAGAAAGTGCGCAAATGGGAGAAGAAATGGGTGACCGTTGGTGACACATCCCTACGAATCTACAAATGGGTCCCTGTGACGGAGCCCAAGGTTGATGACAAAAACAAGAATAAGAAAAAAGGCAAGGACGAGAAGTGTGGCTCAGAGGTGACCACTCCGGAGAACAGTTCCTCCCCAGGGATGATGGACATGCATGACGATAACAGCAACCAGAGCTCCATCGCAGATGCCTCCCCCATCAAACAGGAGAACAGCAGCAACTCCAGCCCCGCTCCAGAGCCCAACTCGGCTGTGCCCAGCGACGGCACCGAGGCCAAGGTGGATGAGGCCCAGGCTGATGGGAAGGAGCACCCAGGAGCTGAAGATGCTTCTGATGAGCAGAATTCACAGTCCTCGATGGAACATTCGATGAACAGCTCAGAGAAAGTAGATCGGCAGCCGTCTGGAGACTCGGGTCTGGCCGCAGAGACGTCTGCAATCTCTCAGGATCTGGAAGGAGTGCCACCCTCTAAAAAGATGAAACTGGAGGCCTCTCAACAAAACTCCGAAGAGATGTAG - Translation Sequence:
MSGRSVRAET RSRAKDDIKR VMAAIEKVRK WEKKWVTVGD TSLRIYKWVP VTEPKVDDKN KNKKKGKDEK CGSEVTTPEN SSSPGMMDMH DDNSNQSSIA DASPIKQENS SNSSPAPEPN SAVPSDGTEA KVDEAQADGK EHPGAEDASD EQNSQSSMEH SMNSSEKVDR QPSGDSGLAA ETSAISQDLE GVPPSKKMKL EASQQNSEEM
Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.
