Product Information
- Product Type
- cDNA
- Antigen Species
- Human
- NCBI Accession No.
- NP_059140.1
- Alternative names
- CHARC1, CHARC15, CHRAC-1, CHRAC-15, CHRAC15, YCL1
- RNA Reference Number
- NM_017444.5
- OMIM Number
- 607268
- Chromosome Location
- 8q24.3
Product Specification
- Formulation
- Lyophilized
- Storage
- Store the plasmid at -20C.
- cDNA size
- 396bp
- Preparation before usage
- 1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
- Vector description:
- This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
- General Description
- CHRAC1 is a histone-fold protein that interacts with other histone-fold proteins to bind DNA in a sequence-independent manner. It forms a complex with DNA polymerase epsilon subunit POLE3 and binds naked DNA, which is then incorporated into chromatin, aided by the nucleosome remodeling activity of ISWI/SNF2H and ACF1.
Data
- Nucleotide Sequence:
ATGGCGGACGTGGTCGTGGGTAAAGACAAGGGCGGGGAGCAGCGGCTCATCTCGCTGCCTCTATCCCGCATCCGGGTCATCATGAAGAGCTCCCCCGAGGTGTCCAGCATCAACCAGGAGGCGTTGGTGCTCACGGCCAAGGCCACGGAGCTCTTTGTTCAATGCCTAGCCACCTATTCCTACAGACACGGCAGTGGAAAGGAAAAGAAAGTACTGACTTACAGTGATTTAGCAAACACTGCACAGCAATCAGAAACTTTTCAGTTTCTTGCAGATATATTACCAAAGAAGATTTTAGCTAGTAAATACCTGAAAATGCTTAAAGAGGAAAAGAGGGAAGAAGATGAGGAGAATGACAATGATAATGAAAGTGACCATGATGAAGCTGACTCCTAA - Translation Sequence:
MADVVVGKDK GGEQRLISLP LSRIRVIMKS SPEVSSINQE ALVLTAKATE LFVQCLATYS YRHGSGKEKK VLTYSDLANT AQQSETFQFL ADILPKKILA SKYLKMLKEE KREEDEENDN DNESDHDEAD S
Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.
