Product Information
- Product Type
- cDNA
- Antigen Species
- Human
- NCBI Accession No.
- NP_002098.1
- Alternative names
- H3.3A, H3F3
- RNA Reference Number
- NM_002107.4
- OMIM Number
- 601128
- Chromosome Location
- 1q42.12
Product Specification
- Formulation
- Lyophilized
- Storage
- Store the plasmid at -20C.
- cDNA size
- 411bp
- Preparation before usage
- 1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
- Vector description:
- This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
- General Description
- H3F3A is a variant histone H3 which replaces conventional H3 in a wide range of nucleosomes in active genes. It constitutes the predominant form of histone H3 in non-dividing cells and is incorporated into chromatin independently of DNA synthesis.
Data
- Nucleotide Sequence:
ATGGCTCGTACAAAGCAGACTGCCCGCAAATCGACCGGTGGTAAAGCACCCAGGAAGCAACTGGCTACAAAAGCCGCTCGCAAGAGTGCGCCCTCTACTGGAGGGGTGAAGAAACCTCATCGTTACAGGCCTGGTACTGTGGCGCTCCGTGAAATTAGACGTTATCAGAAGTCCACTGAACTTCTGATTCGCAAACTTCCCTTCCAGCGTCTGGTGCGAGAAATTGCTCAGGACTTTAAAACAGATCTGCGCTTCCAGAGCGCAGCTATCGGTGCTTTGCAGGAGGCAAGTGAGGCCTATCTGGTTGGCCTTTTTGAAGACACCAACCTGTGTGCTATCCATGCCAAACGTGTAACAATTATGCCAAAAGACATCCAGCTAGCACGCCGCATACGTGGAGAACGTGCTTAA - Translation Sequence:
MARTKQTARK STGGKAPRKQ LATKAARKSA PSTGGVKKPH RYRPGTVALR EIRRYQKSTE LLIRKLPFQR LVREIAQDFK TDLRFQSAAI GALQEASEAY LVGLFEDTNL CAIHAKRVTI MPKDIQLARR IRGERA
Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.
