Product Information
- Product Type
- cDNA
- Antigen Species
- Human
- NCBI Accession No.
- NP_001182060.1
- RNA Reference Number
- NM_001195131.1
- OMIM Number
- Chromosome Location
- 6q16.2
Product Specification
- Formulation
- Lyophilized
- Storage
- Store the plasmid at -20C.
- cDNA size
- 294bp
- Preparation before usage
- 1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
- Vector description:
- This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
- General Description
- TSTD3 contains 1 rhodanese domain that is characterized by an active site cysteine residue that is able to bind sulfane sulfur and catalyse sulfur transfer.
Data
- Nucleotide Sequence:
ATGAAAATAGAAAAGTGTGGCTGGTCTGAAGGTTTGACGTCAATAAAGGGAAACTGCCACAATTTTTATACTGCTATTTCTAAAGATGTCACTTATAAGGAACTTAAAAACCTGTTGAATTCTAAAAATATTATGTTAATTGATGTTAGAGAGATATGGGAAATTCTGGAGTATCAAAAAATCCCTGAGTCTATCAATGTACCATTGGATGAAGTAGGTGAAGCTCTACAGATGAATCCAAGAGACTTCAAAGAGAAGTACAATGAAGTAAAACCATCCAAATCTGACAGCTAG - Translation Sequence:
MKIEKCGWSE GLTSIKGNCH NFYTAISKDV TYKELKNLLN SKNIMLIDVR EIWEILEYQKIPESINVPLD EVGEALQMNP RDFKEKYNEV KPSKSDS
Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.
