ANXA8L2 cDNA

Cat No.
ATGD0110

Size

QTY

List Price

10ug

USD 99


USD 0



Product Information

Product Type
cDNA
Antigen Species
Human
NCBI Accession No.
NP_001621.2
Alternative names
ANXA8, bA145E20.2
RNA Reference Number
NM_001630.2
OMIM Number
Chromosome Location
10q11.22

Product Specification

Formulation
Lyophilized
Storage
Store the plasmid at -20C.
cDNA size
984bp
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
Vector description:
This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
General Description

Data

  1. Nucleotide Sequence:
    ATGGCCTGGTGGAAAGCCTGGATTGAACAGGAGGGTGTCACAGTGAAGAGCAGCTCCCACTTCAACCCAGACCCTGATGCAGAGACCCTCTACAAAGCCATGAAGGGGATCGGGACCAACGAGCAGGCTATCATCGATGTGCTCACCAAGAGAAGCAACACGCAGCGGCAGCAGATCGCCAAGTCCTTCAAGGCTCAGTTCGGCAAGGACCTCACTGAGACCTTGAAGTCTGAGCTCAGTGGCAAGTTTGAGAGGCTCATTGTGGCCCTTATGTACCCGCCATACAGATACGAAGCCAAGGAGCTGCATGACGCCATGAAGGGCTTAGGAACCAAGGAGGGTGTCATCATTGAGATCCTGGCCTCTCGGACCAAGAACCAGCTGCGGGAGATAATGAAGGCGTATGAGGAAGACTATGGGTCCAGCCTGGAGGAGGACATCCAAGCAGACACAAGTGGCTACCTGGAGAGGATCCTGGTGTGCCTCCTGCAGGGCAGCAGGGATGATGTGAGCAGCTTTGTGGACCCGGCACTGGCCCTCCAAGACGCACAGGATCTGTATGCGGCAGGCGAGAATATTCGTGGGACTGATGAGATGAAATTCATCACCATCCTGTGCACGCGCAGTGCCACTCACCTGCTGAGAGTGTTTGAAGAGTATGAGAAAATTGCCAACAAGAGCATTGAGGACAGCATCAAGAGTGAGACCCATGGCTCACTGGAGGAGGCCATGCTCACTGTGGTGAAATGCACCCAAAACCTCCACAGCTACTTTGCAGAGAGACTCTACTATGCCATGAAGGGAGCAGGGACGCGTGATGGGACCCTGATAAGAAACATCGTTTCAAGGAGCGAGATTGACTTAAATCTTATCAAATGTCACTTCAAGAAGATGTACGGCAAGACCCTCAGCAGCATGATCATGGAAGACACCAGCGGTGACTACAAGAACGCCCTGCTGAGCCTGGTGGGCAGCGACCCCTGA
  2. Translation Sequence:
    MAWWKAWIEQ EGVTVKSSSH FNPDPDAETL YKAMKGIGTN EQAIIDVLTK RSNTQRQQIA KSFKAQFGKD LTETLKSELS GKFERLIVAL MYPPYRYEAK ELHDAMKGLG TKEGVIIEIL ASRTKNQLRE IMKAYEEDYG SSLEEDIQAD TSGYLERILV CLLQGSRDDV SSFVDPALAL QDAQDLYAAG ENIRGTDEMK FITILCTRSA THLLRVFEEY EKIANKSIED SIKSETHGSL EEAMLTVVKC TQNLHSYFAE RLYYAMKGAG TRDGTLIRNI VSRSEIDLNL IKCHFKKMYG KTLSSMIMED TSGDYKNALL SLVGSDP

Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.