NUTF2 cDNA

Cat No.
ATGD0115

Size

QTY

List Price

10ug

USD 99


USD 0



Product Information

Product Type
cDNA
Antigen Species
Human
NCBI Accession No.
NP_005787.1
Alternative names
NTF2, PP15
RNA Reference Number
NM_005796.1
OMIM Number
605813
Chromosome Location
16q22.1

Product Specification

Formulation
Lyophilized
Storage
Store the plasmid at -20C.
cDNA size
384bp
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
Vector description:
This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
General Description
NUTF2 encoded by this gene is a cytosolic factor that facilitates protein transport into the nucleus. It interacts with the nuclear pore complex glycoprotein p62. This encoded protein acts at a relative late stage of nuclear protein import, subsequent to the initial docking of nuclear import ligand at the nuclear envelope. It is thought to be part of a multicomponent system of cytosolic factors that assemble at the pore complex during nuclear import.

Data

  1. Nucleotide Sequence:
    ATGGGAGACAAGCCAATTTGGGAGCAGATTGGATCCAGCTTCATTCAACATTACTACCAGTTATTTGATAATGATAGAACCCAACTAGGCGCAATTTACATTGACGCGTCATGCCTTACGTGGGAAGGACAACAGTTCCAGGGGAAAGCTGCCATTGTGGAGAAGTTGTCTAGCCTTCCGTTCCAGAAAATTCAGCACAGCATCACCGCGCAGGACCATCAGCCCACTCCAGATAGCTGCATCATCAGCATGGTTGTGGGCCAGCTTAAGGCGGATGAAGACCCCATCATGGGGTTCCACCAGATGTTCCTATTAAAGAACATCAACGATGCTTGGGTTTGCACCAATGACATGTTCAGGCTCGCCCTGCACAACTTTGGCTGA
  2. Translation Sequence:
    MGDKPIWEQI GSSFIQHYYQ LFDNDRTQLG AIYIDASCLT WEGQQFQGKA AIVEKLSSLP FQKIQHSITA QDHQPTPDSC IISMVVGQLK ADEDPIMGFH QMFLLKNIND AWVCTNDMFR LALHNFG

Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.