STK11 cDNA

Cat No.
ATGD0186

Size

QTY

List Price

10ug

USD 99


USD 0



Product Information

Product Type
cDNA
Antigen Species
Human
NCBI Accession No.
NP_000446.1
Alternative names
hLKB1, LKB1, PJS
RNA Reference Number
NM_000455.4
OMIM Number
602216
Chromosome Location
19p13.3

Product Specification

Formulation
Lyophilized
Storage
Store the plasmid at -20C.
cDNA size
1302bp
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
Vector description:
This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
General Description
STK11, which encodes a member of the serine/threonine kinase family, regulates cell polarity and functions as a tumor suppressor. Mutations in this gene have been associated with Peutz-Jeghers syndrome, an autosomal dominant disorder characterized by the growth of polyps in the gastrointestinal tract, pigmented macules on the skin and mouth, and other neoplasms. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized.

Data

  1. Nucleotide Sequence:
    ATGGAGGTGGTGGACCCGCAGCAGCTGGGCATGTTCACGGAGGGCGAGCTGATGTCGGTGGGTATGGACACGTTCATCCACCGCATCGACTCCACCGAGGTCATCTACCAGCCGCGCCGCAAGCGGGCCAAGCTCATCGGCAAGTACCTGATGGGGGACCTGCTGGGGGAAGGCTCTTACGGCAAGGTGAAGGAGGTGCTGGACTCGGAGACGCTGTGCAGGAGGGCCGTCAAGATCCTCAAGAAGAAGAAGTTGCGAAGGATCCCCAACGGGGAGGCCAACGTGAAGAAGGAAATTCAACTACTGAGGAGGTTACGGCACAAAAATGTCATCCAGCTGGTGGATGTGTTATACAACGAAGAGAAGCAGAAAATGTATATGGTGATGGAGTACTGCGTGTGTGGCATGCAGGAAATGCTGGACAGCGTGCCGGAGAAGCGTTTCCCAGTGTGCCAGGCCCACGGGTACTTCTGTCAGCTGATTGACGGCCTGGAGTACCTGCATAGCCAGGGCATTGTGCACAAGGACATCAAGCCGGGGAACCTGCTGCTCACCACCGGTGGCACCCTCAAAATCTCCGACCTGGGCGTGGCCGAGGCACTGCACCCGTTCGCGGCGGACGACACCTGCCGGACCAGCCAGGGCTCCCCGGCTTTCCAGCCGCCCGAGATTGCCAACGGCCTGGACACCTTCTCCGGCTTCAAGGTGGACATCTGGTCGGCTGGGGTCACCCTCTACAACATCACCACGGGTCTGTACCCCTTCGAAGGGGACAACATCTACAAGTTGTTTGAGAACATCGGGAAGGGGAGCTACGCCATCCCGGGCGACTGTGGCCCCCCGCTCTCTGACCTGCTGAAAGGGATGCTTGAGTACGAACCGGCCAAGAGGTTCTCCATCCGGCAGATCCGGCAGCACAGCTGGTTCCGGAAGAAACATCCTCCGGCTGAAGCACCAGTGCCCATCCCACCGAGCCCAGACACCAAGGACCGGTGGCGCAGCATGACTGTGGTGCCGTACTTGGAGGACCTGCACGGCGCGGACGAGGACGAGGACCTCTTCGACATCGAGGATGACATCATCTACACTCAGGACTTCACGGTGCCCGGACAGGTCCCAGAAGAGGAGGCCAGTCACAATGGACAGCGCCGGGGCCTCCCCAAGGCCGTGTGTATGAACGGCACAGAGGCGGCGCAGCTGAGCACCAAATCCAGGGCGGAGGGCCGGGCCCCCAACCCTGCCCGCAAGGCCTGCTCCGCCAGCAGCAAGATCCGCCGGCTGTCGGCCTGCAAGCAGCAGTGA
  2. Translation Sequence:
    MEVVDPQQLG MFTEGELMSV GMDTFIHRID STEVIYQPRR KRAKLIGKYL MGDLLGEGSY GKVKEVLDSE TLCRRAVKIL KKKKLRRIPN GEANVKKEIQ LLRRLRHKNV IQLVDVLYNE EKQKMYMVME YCVCGMQEML DSVPEKRFPV CQAHGYFCQL IDGLEYLHSQ GIVHKDIKPG NLLLTTGGTL KISDLGVAEA LHPFAADDTC RTSQGSPAFQ PPEIANGLDT FSGFKVDIWS AGVTLYNITT GLYPFEGDNI YKLFENIGKG SYAIPGDCGP PLSDLLKGML EYEPAKRFSI RQIRQHSWFR KKHPPAEAPV PIPPSPDTKD RWRSMTVVPY LEDLHGADED EDLFDIEDDI IYTQDFTVPG QVPEEEASHN GQRRGLPKAV CMNGTEAAQL STKSRAEGRA PNPARKACSA SSKIRRLSAC KQQ

Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.