NACC1 cDNA

Cat No.
ATGD0267

Size

QTY

List Price

10ug

USD 99


USD 0



Product Information

Product Type
cDNA
Antigen Species
Human
NCBI Accession No.
NP_443108.1
Alternative names
BEND8, BTBD14B, BTBD30, NAC-1, NAC1
RNA Reference Number
NM_052876.3
OMIM Number
610672
Chromosome Location
19p13.2

Product Specification

Formulation
Lyophilized
Storage
Store the plasmid at -20C.
cDNA size
1584bp
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
Vector description:
This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
General Description
NACC1 is a member of the BTB/POZ protein family. BTB/POZ proteins are involved in several cellular processes including proliferation, apoptosis and transcription regulation. It is a transcriptional repressor that plays a role in stem cell self-renewal and pluripotency maintenance. A pseudogene of this gene is located on the short arm of chromosome 9.

Data

  1. Nucleotide Sequence:
    ATGGCCCAGACACTGCAGATGGAGATCCCGAACTTCGGCAACAGCATCCTGGAGTGCCTCAATGAACAGCGGCTGCAGGGCCTGTACTGTGACGTGTCAGTGGTGGTCAAGGGCCATGCCTTCAAGGCCCACCGGGCCGTGCTTGCTGCCAGCAGCTCCTACTTCCGGGACCTGTTCAACAACAGCCGCAGCGCCGTGGTGGAGCTGCCGGCGGCTGTGCAGCCCCAGTCTTTCCAGCAGATCCTCAGCTTCTGCTACACGGGCCGGCTGAGCATGAACGTGGGCGACCAGTTCCTGCTCATGTACACGGCTGGCTTCCTGCAGATCCAGGAGATCATGGAGAAGGGCACCGAGTTCTTCCTCAAGGTGAGCTCCCCGAGCTGCGACTCCCAGGGCCTGCATGCGGAGGAGGCCCCATCGTCGGAGCCCCAGAGCCCCGTGGCGCAGACATCGGGCTGGCCAGCCTGTAGCACCCCGCTGCCCCTCGTGTCGCGGGTGAAGACGGAGCAGCAGGAGTCGGACTCCGTGCAGTGCATGCCCGTGGCCAAGCGGCTGTGGGACAGTGGCCAGAAGGAGGCTGGGGGCGGCGGCAATGGCAGCCGCAAGATGGCCAAGTTCTCCACGCCGGACCTGGCTGCCAACCGGCCTCACCAGCCCCCGCCACCCCAACAGGCTCCGGTGGTGGCAGCAGCCCAGCCCGCCGTGGCTGCGGGAGCAGGGCAGCCAGCCGGTGGGGTGGCAGCAGCAGGGGGTGTGGTGAGTGGGCCCAGCACGTCGGAGCGGACCAGCCCAGGCACCTCAAGCGCCTACACCAGCGACAGCCCTGGCTCCTACCACAATGAGGAGGACGAGGAGGAGGATGGTGGCGAGGAGGGCATGGATGAGCAGTACCGGCAGATCTGCAACATGTACACCATGTACAGCATGATGAACGTCGGCCAGACAGCCGAGAAGGTGGAGGCCCTCCCGGAGCAGGTAGCCCCCGAGTCCCGAAATCGCATCCGGGTTCGGCAAGACCTGGCGTCTCTCCCGGCTGAACTTATCAACCAGATTGGGAACCGCTGCCACCCCAAGCTCTACGACGAGGGCGACCCCTCTGAGAAGCTGGAGCTGGTGACAGGCACCAACGTGTACATCACAAGGGCGCAGCTGATGAACTGCCACGTCAGCGCAGGCACGCGGCACAAGGTCCTACTGCGGCGGCTCCTGGCCTCCTTCTTTGACCGGAACACGCTGGCCAACAGCTGCGGCACCGGCATCCGCTCTTCTACCAACGATCCCCGTCGGAAGCCCCTGGACAGCCGCGTGCTCCACGCTGTCAAGTACTACTGCCAGAACTTCGCCCCCAACTTCAAGGAGAGCGAGATGAATGCCATCGCGGCCGACATGTGCACCAACGCCCGCCGCGTCGTGCGCAAGAGCTGGATGCCCAAGGTCAAGGTGCTCAAGGCTGAGGATGACGCCTACACCACCTTCATCAGTGAAACGGGCAAGATCGAGCCGGACATGATGGGTGTGGAGCATGGCTTCGAGACCGCCAGCCACGAGGGCGAGGCGGGTCCCTCGGCTGAAGCCCTGCAGTAA
  2. Translation Sequence:
    MAQTLQMEIP NFGNSILECL NEQRLQGLYC DVSVVVKGHA FKAHRAVLAA SSSYFRDLFN NSRSAVVELP AAVQPQSFQQ ILSFCYTGRL SMNVGDQFLL MYTAGFLQIQ EIMEKGTEFF LKVSSPSCDS QGLHAEEAPS SEPQSPVAQT SGWPACSTPL PLVSRVKTEQ QESDSVQCMP VAKRLWDSGQ KEAGGGGNGS RKMAKFSTPD LAANRPHQPP PPQQAPVVAA AQPAVAAGAG QPAGGVAAAG GVVSGPSTSE RTSPGTSSAY TSDSPGSYHN EEDEEEDGGE EGMDEQYRQI CNMYTMYSMM NVGQTAEKVE ALPEQVAPES RNRIRVRQDL ASLPAELINQ IGNRCHPKLY DEGDPSEKLE LVTGTNVYIT RAQLMNCHVS AGTRHKVLLR RLLASFFDRN TLANSCGTGI RSSTNDPRRK PLDSRVLHAV KYYCQNFAPN FKESEMNAIA ADMCTNARRV VRKSWMPKVK VLKAEDDAYT TFISETGKIE PDMMGVEHGF ETASHEGEAG PSAEALQ

Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.