LGALS7 cDNA

Cat No.
ATGD0312

Size

QTY

List Price

10ug

USD 99


USD 0



Product Information

Product Type
cDNA
Antigen Species
Mouse
NCBI Accession No.
NP_032522.2
Alternative names
Galectin-7, Pig1
RNA Reference Number
NM_008496.4
OMIM Number
Chromosome Location
7

Product Specification

Formulation
Lyophilized
Storage
Store the plasmid at -20C.
cDNA size
411bp
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
Vector description:
This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
General Description
LGALS7 (galectin7) is a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. Members of this family have been implicated in a variety of functions, including growth regulation, cell adhesion, migration, neoplastic transformation, and immune responses. It is expressed mainly in stratified squamous epithelium, LGALS7 protein is activated by p53 and repressed by retinoic acid.

Data

  1. Nucleotide Sequence:
    ATGTCTGCTACCCAGCACAAGACCTCCCTGCCTCAGGGCGTCCGCGTGGGCACTGTCATGAGAATTCGAGGCATGGTCCCTGACCAGGCTGGCAGGTTCCATGTAAACCTGCTATGCGGTGAGGAGCAAGGAGCAGATGCCGCCTTGCACTTTAACCCGAGGCTGGACACTTCCGAGGTTGTCTTCAACACCAAAGAACAAGGCAAATGGGGCCGTGAGGAGCGAGGCACCGGCATCCCCTTCGAGCGTGGGCAGCCCTTTGAAGTGCTCCTCATCGCCACAGAGGAAGGCTTCAAGGCTGTGGTCGGGGATGACGAATATCTCCACTTCCACCACCGGATGCCGCCCGCGCGCGTGCGCTTGGTGGAGGTGGGCGGAGACGTGCAGCTGCATTCAGTGAAGATCTTCTAA
  2. Translation Sequence:
    MSATQHKTSL PQGVRVGTVM RIRGMVPDQA GRFHVNLLCG EEQGADAALH FNPRLDTSEVVFNTKEQGKW GREERGTGIP FERGQPFEVL LIATEEGFKA VVGDDEYLHF HHRMPPARVRLVEVGGDVQL HSVKIF

Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.