NKX3-1 cDNA

Cat No.
ATGD0320

Size

QTY

List Price

10ug

USD 99


USD 0



Product Information

Product Type
cDNA
Antigen Species
Human
NCBI Accession No.
NP_006158.2
Alternative names
BAPX2, NKX3, NKX3.1, NKX3A
RNA Reference Number
NM_006167.3
OMIM Number
602041
Chromosome Location
8p21.2

Product Specification

Formulation
Lyophilized
Storage
Store the plasmid at -20C.
cDNA size
705bp
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
Vector description:
This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
General Description
NKX3-1 encodes a homeobox-containing transcription factor. This transcription factor functions as a negative regulator of epithelial cell growth in prostate tissue. Aberrant expression of NKX3-1 is associated with prostate tumor progression. Alternate splicing results in multiple transcript variants of NKX3-1.

Data

  1. Nucleotide Sequence:
    ATGCTCAGGGTTCCGGAGCCGCGGCCCGGGGAGGCGAAAGCGGAGGGGGCCGCGCCGCCGACCCCGTCCAAGCCGCTCACGTCCTTCCTCATCCAGGACATCCTGCGGGACGGCGCGCAGCGGCAAGGCGGCCGCACGAGCAGCCAGAGACAGCGCGACCCGGAGCCGGAGCCAGAGCCAGAGCCAGAGGGAGGACGCAGCCGCGCCGGGGCGCAGAACGACCAGCTGAGCACCGGGCCCCGCGCCGCGCCGGAGGAGGCCGAGACGCTGGCAGAGACCGAGCCAGAAAGGCACTTGGGGTCTTATCTGTTGGACTCTGAAAACACTTCAGGCGCCCTTCCAAGGCTTCCCCAAACCCCTAAGCAGCCGCAGAAGCGCTCCCGAGCTGCCTTCTCCCACACTCAGGTGATCGAGTTGGAGAGGAAGTTCAGCCATCAGAAGTACCTGTCGGCCCCTGAACGGGCCCACCTGGCCAAGAACCTCAAGCTCACGGAGACCCAAGTGAAGATATGGTTCCAGAACAGACGCTATAAGACTAAGCGAAAGCAGCTCTCCTCGGAGCTGGGAGACTTGGAGAAGCACTCCTCTTTGCCGGCCCTGAAAGAGGAGGCCTTCTCCCGGGCCTCCCTGGTCTCCGTGTATAACAGCTATCCTTACTACCCATACCTGTACTGCGTGGGCAGCTGGAGCCCAGCTTTTTGGTAA
  2. Translation Sequence:
    MLRVPEPRPG EAKAEGAAPP TPSKPLTSFL IQDILRDGAQ RQGGRTSSQR QRDPEPEPEPEPEGGRSRAG AQNDQLSTGP RAAPEEAETL AETEPERHLG SYLLDSENTS GALPRLPQTPKQPQKRSRAA FSHTQVIELE RKFSHQKYLS APERAHLAKN LKLTETQVKI WFQNRRYKTKRKQLSSELGD LEKHSSLPAL KEEAFSRASL VSVYNSYPYY PYLYCVGSWS PAFW

Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.