CEBPE cDNA

Cat No.
ATGD0366

Size

QTY

List Price

10ug

USD 99


USD 0



Product Information

Product Type
cDNA
Antigen Species
Human
NCBI Accession No.
NP_001796.2
Alternative names
C/EBP-epsilon, CRP1
RNA Reference Number
NM_001805.3
OMIM Number
600749
Chromosome Location
14q11.2

Product Specification

Formulation
Lyophilized
Storage
Store the plasmid at -20C.
cDNA size
846bp
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
Vector description:
This shuttle vector contains the complete ORF. It is inseted BamH I to Hind III. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
General Description
CEBPE is a bZIP transcription factor which can bind as a homodimer to certain DNA regulatory regions. It can also form heterodimers with the related protein CEBP-delta. Multiple variants of this gene have been described, but the full-length nature of only one has been determined.

Data

  1. Nucleotide Sequence:
    ATGTCCCACGGGACCTACTACGAGTGTGAGCCCCGGGGTGGCCAGCAGCCACTCGAGTTCTCAGGGGGCCGAGCTGGGCCCGGGGAGCTAGGGGACATGTGTGAGCATGAGGCCTCCATTGACCTCTCCGCCTACATCGAGTCTGGGGAAGAGCAGCTTCTCTCCGATCTCTTTGCCGTGAAGCCAGCGCCTGAGGCCAGAGGCCTCAAGGGCCCCGGAACCCCTGCCTTCCCCCACTACTTGCCGCCTGACCCTCGGCCCTTTGCCTACCCTCCACATACCTTCGGCCCAGACAGGAAGGCGCTGGGGCCTGGCATCTACAGCAGCCCAGGGAGCTACGACCCCAGGGCTGTGGCGGTGAAGGAGGAGCCCCGGGGGCCAGAGGGCAGCCGAGCTGCCAGCCGAGGCAGCTACAATCCCCTGCAGTACCAAGTGGCACACTGTGGGCAGACAGCCATGCACCTGCCCCCAACTCTGGCAGCACCCGGCCAGCCTCTGCGCGTTCTCAAGGCCCCTTTGGCCACTGCCGCACCCCCCTGCAGTCCCCTCCTGAAGGCGCCCTCCCCGGCTGGCCCCTTACACAAGGGCAAGAAGGCAGTGAACAAAGATAGCCTTGAGTACCGGCTGAGGCGGGAGCGCAACAACATCGCCGTGCGCAAGAGCCGAGACAAGGCCAAGAGGCGCATTCTGGAGACGCAGCAGAAGGTGCTGGAGTACATGGCAGAGAACGAGCGCCTCCGCAGCCGCGTGGAGCAGCTCACCCAGGAGCTAGACACCCTCCGCAACCTCTTCCGCCAGATTCCTGAGGCGGCCAACCTCATCAAGGGCGTGGGGGGTTGCAGCTGA
  2. Translation Sequence:
    MSHGTYYECE PRGGQQPLEF SGGRAGPGEL GDMCEHEASI DLSAYIESGE EQLLSDLFAV KPAPEARGLK GPGTPAFPHY LPPDPRPFAY PPHTFGPDRK ALGPGIYSSP GSYDPRAVAV KEEPRGPEGS RAASRGSYNP LQYQVAHCGQ TAMHLPPTLA APGQPLRVLK APLATAAPPC SPLLKAPSPA GPLHKGKKAV NKDSLEYRLR RERNNIAVRK SRDKAKRRIL ETQQKVLEYM AENERLRSRV EQLTQELDTL RNLFRQIPEA ANLIKGVGGC S

Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.