RAP2B cDNA

Cat No.
ATGD0385

Size

QTY

List Price

10ug

USD 99


USD 0



Product Information

Product Type
cDNA
Antigen Species
Human
NCBI Accession No.
NP_002877.2
RNA Reference Number
NM_002886.3
OMIM Number
179541
Chromosome Location
3q25.2

Product Specification

Formulation
Lyophilized
Storage
Store the plasmid at -20C.
cDNA size
552bp
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
Vector description:
This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
General Description
RAP2B belongs to the Ras-related protein family. RAP2B is small GTP-binding protein which cycles between a GDP-bound inactive and a GTP-bound active form. It is involved in EGFR and CHRM3 signaling pathways through stimulation of PLCE1.

Data

  1. Nucleotide Sequence:
    ATGAGAGAGTACAAAGTGGTGGTGCTGGGCTCGGGCGGCGTGGGCAAGTCCGCGCTCACCGTGCAGTTCGTGACGGGCTCCTTCATCGAGAAGTACGACCCGACCATCGAAGACTTTTACCGCAAGGAGATTGAGGTGGACTCGTCGCCGTCGGTGCTGGAGATCCTGGATACGGCGGGCACCGAGCAGTTCGCGTCCATGCGGGACCTGTACATCAAGAACGGCCAGGGCTTCATCCTGGTCTACAGCCTCGTCAACCAGCAGAGCTTCCAGGACATCAAGCCCATGCGGGACCAGATCATCCGCGTGAAGCGGTACGAGCGCGTGCCCATGATCCTGGTGGGCAACAAGGTGGACCTGGAGGGTGAGCGCGAGGTCTCGTACGGGGAGGGCAAGGCCCTGGCTGAGGAGTGGAGCTGCCCCTTCATGGAGACGTCGGCCAAAAACAAAGCCTCGGTAGACGAGCTATTTGCCGAGATCGTGCGGCAGATGAACTACGCGGCGCAGCCCAACGGCGATGAGGGCTGCTGCTCGGCCTGCGTGATCCTCTGA
  2. Translation Sequence:
    MREYKVVVLG SGGVGKSALT VQFVTGSFIE KYDPTIEDFY RKEIEVDSSP SVLEILDTAGTEQFASMRDL YIKNGQGFIL VYSLVNQQSF QDIKPMRDQI IRVKRYERVP MILVGNKVDLEGEREVSYGE GKALAEEWSC PFMETSAKNK ASVDELFAEI VRQMNYAAQP NGDEGCCSACVIL

Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.