MDS1 cDNA

Cat No.
ATGD0398

Size

QTY

List Price

10ug

USD 99


USD 0



Product Information

Product Type
cDNA
Antigen Species
Human
NCBI Accession No.
NP_004982.1
Alternative names
MDS1-EVI1, PRDM3
RNA Reference Number
NM_004991.2
OMIM Number
600049
Chromosome Location
3q26

Product Specification

Formulation
Lyophilized
Storage
Store the plasmid at -20C.
cDNA size
510bp
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
Vector description:
This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
General Description
MDS1 is a transcriptional regulator and oncoprotein that may be involved in hematopoiesis, apoptosis, development, and cell differentiation and proliferation. Several transcript variants encoding a few different isoforms have been found for this gene.

Data

  1. Nucleotide Sequence:
    ATGAGATCCAAAGGCAGGGCAAGGAAACTGGCCACAAATAATGAGTGTGTATATGGCAACTACCCTGAAATACCTTTGGAAGAAATGCCAGATGCAGATGGAGTAGCCAGCACTCCCTCCCTCAATATTCAAGAGCCATGCTCTCCTGCCACATCCAGTGAAGCATTCACTCCAAAGGAGGGTTCTCCTTACAAAGCCCCCATCTACATCCCTGATGATATCCCCATTCCTGCTGAGTTTGAACTTCGAGAGTCAAATATGCCTGGGGCAGGACTAGGAATATGGACCAAAAGGAAGATCGAAGTAGGTGAAAAGTTTGGGCCTTATGTGGGAGAGCAGAGGTCAAACCTGAAAGACCCCAGTTATGGATGGGAGGTACATCTTCCAAGGTCTCGGAGGGTAAGCGTTCACTCTTGGTTGTATTTGGGGAAGAGAAGCTCAGACGTAGGAATAGCCTTCTCTCAGGCTGATGTCTACATGCCTGGACTGCAGTGTGCCTTCCTCTCGTAG
  2. Translation Sequence:
    MRSKGRARKL ATNNECVYGN YPEIPLEEMP DADGVASTPS LNIQEPCSPA TSSEAFTPKE GSPYKAPIYI PDDIPIPAEF ELRESNMPGA GLGIWTKRKI EVGEKFGPYV GEQRSNLKDP SYGWEVHLPR SRRVSVHSWL YLGKRSSDVG IAFSQADVYM PGLQCAFLS

Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.