GULP1 cDNA

Cat No.
ATGD0404

Size

QTY

List Price

10ug

USD 99


USD 0



Product Information

Product Type
cDNA
Antigen Species
Human
NCBI Accession No.
NP_057399.1
Alternative names
CED-6, CED6, GULP
RNA Reference Number
NM_016315.3
OMIM Number
608165
Chromosome Location
2q32.3-q33

Product Specification

Formulation
Lyophilized
Storage
Store the plasmid at -20C.
cDNA size
915bp
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
Vector description:
This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
General Description
GULP1 is an adapter protein necessary for the engulfment of apoptotic cells by phagocytes. Several transcript variants, some protein coding and some thought not to be protein coding, have been found for this gene.

Data

  1. Nucleotide Sequence:
    ATGAACCGTGCTTTTAGCAGGAAGAAAGACAAAACATGGATGCATACACCTGAAGCTTTATCAAAACATTTCATTCCCTATAATGCAAAGTTTCTTGGCAGTACAGAAGTGGAACAGCCAAAAGGAACAGAAGTTGTGAGAGATGCTGTAAGGAAACTAAAGTTTGCAAGACATATCAAGAAATCTGAAGGCCAGAAAATTCCTAAAGTGGAGTTGCAAATATCAATTTATGGAGTAAAAATTCTAGAACCCAAAACAAAGGAAGTTCAACACAATTGCCAGCTTCATAGAATATCTTTTTGTGCAGATGATAAAACTGACAAGAGGATATTCACTTTCATATGCAAAGATTCTGAGTCAAATAAACATTTGTGCTATGTATTTGACAGCGAAAAGTGTGCTGAAGAGATCACTTTAACAATTGGCCAAGCATTTGACCTGGCATACAGGAAATTTCTAGAATCAGGAGGAAAAGATGTTGAAACAAGAAAACAGATCGCAGGGTTACAAAAAAGAATCCAAGACTTAGAAACAGAAAATATGGAACTTAAAAATAAAGTACAAGATTTGGAAAACCAACTGAGAATAACTCAAGTATCAGCACCTCCAGCAGGCAGTATGACACCTAAGTCGCCCTCCACTGACATCTTTGATATGATTCCATTTTCTCCAATATCACACCAGTCTTCGATGCCTACTCGCAATGGCACACAGCCACCTCCAGTACCTAGTAGATCTACTGAGATTAAACGGGACCTGTTTGGAGCAGAACCTTTTGACCCATTTAACTGTGGAGCAGCAGATTTCCCTCCAGATATTCAATCAAAATTAGATGAGATGCAGGAGGGGTTCAAAATGGGACTAACTCTTGAAGGCACAGTATTTTGTCTCGACCCGTTAGACAGTAGGTGCTGA
  2. Translation Sequence:
    MNRAFSRKKD KTWMHTPEAL SKHFIPYNAK FLGSTEVEQP KGTEVVRDAV RKLKFARHIK KSEGQKIPKV ELQISIYGVK ILEPKTKEVQ HNCQLHRISF CADDKTDKRI FTFICKDSES NKHLCYVFDS EKCAEEITLT IGQAFDLAYR KFLESGGKDV ETRKQIAGLQ KRIQDLETEN MELKNKVQDL ENQLRITQVS APPAGSMTPK SPSTDIFDMI PFSPISHQSS MPTRNGTQPP PVPSRSTEIK RDLFGAEPFD PFNCGAADFP PDIQSKLDEM QEGFKMGLTL EGTVFCLDPL DSRC

Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.