MRI cDNA

Cat No.
ATGD0417

Size

QTY

List Price

10ug

USD 99


USD 0



Product Information

Product Type
cDNA
Antigen Species
Human
NCBI Accession No.
NP_076938.2
Alternative names
C7orf49
RNA Reference Number
NM_024033.2
OMIM Number
Chromosome Location
7q33

Product Specification

Formulation
Lyophilized
Storage
Store the plasmid at -20C.
cDNA size
474bp
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
Vector description:
This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
General Description
MRI (modulator of retrovirus infection homolog) characterizes the hamster ortholog and suggests that it may modulate the ability of the proteasome to degrade retroviral cores upon cellular infection.

Data

  1. Nucleotide Sequence:
    ATGGAAACCTTACAATCCGAGACTAAAACGAGGGTCCTTCCCTCATGGCTGACAGCCCAGGTGGCTACAAAGAATGTGGCACCAATGAAGGCCCCCAAGAGGATGAGAATGGCAGCAGTGCCAGTGGCAGCAGCAAGACTCCCTGCGACAAGGACTGTGTACTGCATGAATGAGGCTGAGATAGTTGATGTTGCTCTGGGAATCCTGATTGAGAGCCGCAAACAGGAAAAGGCCTGCGAGCAGCCGGCCCTGGCGGGGGCTGATAACCCAGAGCACTCCCCTCCCTGCTCCGTGTCGCCTCACACAAGTTCTGGGAGCAGCAGTGAGGAAGAGGACAGTGGGAAACAGGCACTGGCTCCAGGCCTCAGCCCTTCCCAGAGGCCGGGGGGTTCCAGCTCTGCCTGTAGCAGGAGCCCTGAGGAGGAGGAGGAAGAGGATGTGCTGAAATACGTCCGGGAGATCTTTTTCAGCTAG
  2. Translation Sequence:
    METLQSETKT RVLPSWLTAQ VATKNVAPMK APKRMRMAAV PVAAARLPAT RTVYCMNEAE IVDVALGILI ESRKQEKACE QPALAGADNP EHSPPCSVSP HTSSGSSSEE EDSGKQALAP GLSPSQRPGG SSSACSRSPE EEEEEDVLKY VREIFFS

Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.