BCHE cDNA

Cat No.
ATGD0421

Size

QTY

List Price

10ug

USD 99


USD 0



Product Information

Product Type
cDNA
Antigen Species
Human
NCBI Accession No.
NP_000046.1
Alternative names
CHE1, CHE2, E1
RNA Reference Number
NM_000055.2
OMIM Number
177400
Chromosome Location
3q26.1-q26.2

Product Specification

Formulation
Lyophilized
Storage
Store the plasmid at -20C.
cDNA size
1809bp
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
Vector description:
This shuttle vector contains the complete ORF. It is inseted Apa I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
General Description
BCHE belongs to the type-B carboxylesterase/lipase family. Mutant alleles at the BCHE locus are responsible for suxamethonium sensitivity. Defects in BCHE are the cause of butyrylcholinesterase deficiency (BChE deficiency). BChE deficiency is a metabolic disorder characterized by prolonged apnoea after the use of certain anesthetic drugs, including the muscle relaxants succinylcholine or mivacurium and other ester local anesthetics

Data

  1. Nucleotide Sequence:
    ATGCATAGCAAAGTCACAATCATATGCATCAGATTTCTCTTTTGGTTTCTTTTGCTCTGCATGCTTATTGGGAAGTCACATACTGAAGATGACATCATAATTGCAACAAAGAATGGAAAAGTCAGAGGGATGAACTTGACAGTTTTTGGTGGCACGGTAACAGCCTTTCTTGGAATTCCCTATGCACAGCCACCTCTTGGTAGACTTCGATTCAAAAAGCCACAGTCTCTGACCAAGTGGTCTGATATTTGGAATGCCACAAAATATGCAAATTCTTGCTGTCAGAACATAGATCAAAGTTTTCCAGGCTTCCATGGATCAGAGATGTGGAACCCAAACACTGACCTCAGTGAAGACTGTTTATATCTAAATGTATGGATTCCAGCACCTAAACCAAAAAATGCCACTGTATTGATATGGATTTATGGTGGTGGTTTTCAAACTGGAACATCATCTTTACATGTTTATGATGGCAAGTTTCTGGCTCGGGTTGAAAGAGTTATTGTAGTGTCAATGAACTATAGGGTGGGTGCCCTAGGATTCTTAGCTTTGCCAGGAAATCCTGAGGCTCCAGGGAACATGGGTTTATTTGATCAACAGTTGGCTCTTCAGTGGGTTCAAAAAAATATAGCAGCCTTTGGTGGAAATCCTAAAAGTGTAACTCTCTTTGGAGAAAGTGCAGGAGCAGCTTCAGTTAGCCTGCATTTGCTTTCTCCTGGAAGCCATTCATTGTTCACCAGAGCCATTCTGCAAAGTGGATCCTTTAATGCTCCTTGGGCGGTAACATCTCTTTATGAAGCTAGGAACAGAACGTTGAACTTAGCTAAATTGACTGGTTGCTCTAGAGAGAATGAGACTGAAATAATCAAGTGTCTTAGAAATAAAGATCCCCAAGAAATTCTTCTGAATGAAGCATTTGTTGTCCCCTATGGGACTCCTTTGTCAGTAAACTTTGGTCCGACCGTGGATGGTGATTTTCTCACTGACATGCCAGACATATTACTTGAACTTGGACAATTTAAAAAAACCCAGATTTTGGTGGGTGTTAATAAAGATGAAGGGACAGCTTTTTTAGTCTATGGTGCTCCTGGCTTCAGCAAAGATAACAATAGTATCATAACTAGAAAAGAATTTCAGGAAGGTTTAAAAATATTTTTTCCAGGAGTGAGTGAGTTTGGAAAGGAATCCATCCTTTTTCATTACACAGACTGGGTAGATGATCAGAGACCTGAAAACTACCGTGAGGCCTTGGGTGATGTTGTTGGGGATTATAATTTCATATGCCCTGCCTTGGAGTTCACCAAGAAGTTCTCAGAATGGGGAAATAATGCCTTTTTCTACTATTTTGAACACCGATCCTCCAAACTTCCGTGGCCAGAATGGATGGGAGTGATGCATGGCTATGAAATTGAATTTGTCTTTGGTTTACCTCTGGAAAGAAGAGATAATTACACAAAAGCCGAGGAAATTTTGAGTAGATCCATAGTGAAACGGTGGGCAAATTTTGCAAAATATGGGAATCCAAATGAGACTCAGAACAATAGCACAAGCTGGCCTGTCTTCAAAAGCACTGAACAAAAATATCTAACCTTGAATACAGAGTCAACAAGAATAATGACGAAACTACGTGCTCAACAATGTCGATTCTGGACATCATTTTTTCCAAAAGTCTTGGAAATGACAGGAAATATTGATGAAGCAGAATGGGAGTGGAAAGCAGGATTCCATCGCTGGAACAATTACATGATGGACTGGAAAAATCAATTTAACGATTACACTAGCAAGAAAGAAAGTTGTGTGGGTCTCTAA
  2. Translation Sequence:
    MHSKVTIICI RFLFWFLLLC MLIGKSHTED DIIIATKNGK VRGMNLTVFG GTVTAFLGIP YAQPPLGRLR FKKPQSLTKW SDIWNATKYA NSCCQNIDQS FPGFHGSEMW NPNTDLSEDC LYLNVWIPAP KPKNATVLIW IYGGGFQTGT SSLHVYDGKF LARVERVIVV SMNYRVGALG FLALPGNPEA PGNMGLFDQQ LALQWVQKNI AAFGGNPKSV TLFGESAGAA SVSLHLLSPG SHSLFTRAIL QSGSFNAPWA VTSLYEARNR TLNLAKLTGC SRENETEIIK CLRNKDPQEI LLNEAFVVPY GTPLSVNFGP TVDGDFLTDM PDILLELGQF KKTQILVGVN KDEGTAFLVY GAPGFSKDNN SIITRKEFQE GLKIFFPGVS EFGKESILFH YTDWVDDQRP ENYREALGDV VGDYNFICPA LEFTKKFSEW GNNAFFYYFE HRSSKLPWPE WMGVMHGYEI EFVFGLPLER RDNYTKAEEI LSRSIVKRWA NFAKYGNPNE TQNNSTSWPV FKSTEQKYLT LNTESTRIMT KLRAQQCRFW TSFFPKVLEM TGNIDEAEWE WKAGFHRWNN YMMDWKNQFN DYTSKKESCV GL

Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.