CAV2 cDNA

Cat No.
ATGD0425

Size

QTY

List Price

10ug

USD 99


USD 0



Product Information

Product Type
cDNA
Antigen Species
Human
NCBI Accession No.
NP_001224.1
Alternative names
CAV
RNA Reference Number
NM_001233.4
OMIM Number
601048
Chromosome Location
7q31.1

Product Specification

Formulation
Lyophilized
Storage
Store the plasmid at -20C.
cDNA size
489bp
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
Vector description:
This shuttle vector contains the complete ORF. It is inseted Nde I to Hind III. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
General Description
CAV2 belongs to the caveolin family and may act as a scaffolding protein within caveolar membranes. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. Additional isoforms resulting from the use of alternate in-frame translation initiation codons have also been described, and shown to have preferential localization in the cell.

Data

  1. Nucleotide Sequence:
    ATGGGGCTGGAGACGGAGAAGGCGGACGTACAGCTCTTCATGGACGACGACTCCTACAGCCACCACAGCGGCCTCGAGTACGCCGACCCCGAGAAGTTCGCGGACTCGGACCAGGACCGGGATCCCCACCGGCTCAACTCGCATCTCAAGCTGGGCTTCGAGGATGTGATCGCAGAGCCGGTGACTACGCACTCCTTTGACAAAGTGTGGATCTGCAGCCATGCCCTCTTTGAAATCAGCAAATACGTAATGTACAAGTTCCTGACGGTGTTCCTGGCCATTCCCCTGGCCTTCATTGCGGGAATTCTCTTTGCCACCCTCAGCTGTCTGCACATCTGGATTTTAATGCCTTTTGTAAAGACCTGCCTAATGGTTCTGCCTTCAGTGCAGACAATATGGAAGAGTGTGACAGATGTTATCATTGCTCCATTGTGTACGAGCGTAGGACGATGCTTCTCTTCTGTCAGCCTGCAACTGAGCCAGGATTGA
  2. Translation Sequence:
    MGLETEKADV QLFMDDDSYS HHSGLEYADP EKFADSDQDR DPHRLNSHLK LGFEDVIAEP VTTHSFDKVW ICSHALFEIS KYVMYKFLTV FLAIPLAFIA GILFATLSCL HIWILMPFVK TCLMVLPSVQ TIWKSVTDVI IAPLCTSVGR CFSSVSLQLS QD

Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.