TWIST2 cDNA

Cat No.
ATGD0427

Size

QTY

List Price

10ug

USD 99


USD 0



Product Information

Product Type
cDNA
Antigen Species
Human
NCBI Accession No.
NP_476527.1
Alternative names
bHLHa39, DERMO1, FFDD3, SETLSS
RNA Reference Number
NM_057179.2
OMIM Number
607556
Chromosome Location
2q37.3

Product Specification

Formulation
Lyophilized
Storage
Store the plasmid at -20C.
cDNA size
483bp
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
Vector description:
This shuttle vector contains the complete ORF. It is inseted BamH I to Hind III. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
General Description
TWIST2 is a basic helix-loop-helix type transcription factor and shares similarity with Twist. It may inhibit osteoblast maturation and maintain cells in a preosteoblast phenotype during osteoblast development. Mutations in this gene cause focal facial dermal dysplasia 3, Setleis type.

Data

  1. Nucleotide Sequence:
    ATGGAGGAGGGCTCCAGCTCGCCCGTGTCCCCCGTGGACAGCCTGGGCACCAGCGAGGAGGAGCTCGAGAGGCAGCCCAAGCGCTTCGGCCGGAAGCGGCGCTACAGCAAGAAGTCGAGCGAAGATGGCAGCCCGACCCCGGGCAAGCGCGGCAAGAAGGGCAGCCCCAGCGCGCAGTCCTTCGAGGAGCTGCAGAGCCAGCGCATCCTGGCCAACGTGCGCGAGCGCCAGCGCACCCAGTCGCTCAACGAGGCCTTCGCGGCGCTGCGCAAGATCATCCCCACGCTGCCCTCTGACAAGCTGAGCAAGATCCAGACGCTCAAGCTGGCCGCCAGGTACATAGACTTCCTCTACCAGGTCCTGCAGAGCGACGAGATGGACAATAAGATGACCAGCTGCAGCTACGTGGCCCACGAGCGCCTCAGCTACGCCTTCTCCGTGTGGCGCATGGAGGGCGCGTGGTCCATGTCCGCCTCCCACTAG
  2. Translation Sequence:
    MEEGSSSPVS PVDSLGTSEE ELERQPKRFG RKRRYSKKSS EDGSPTPGKR GKKGSPSAQS FEELQSQRIL ANVRERQRTQ SLNEAFAALR KIIPTLPSDK LSKIQTLKLA ARYIDFLYQV LQSDEMDNKM TSCSYVAHER LSYAFSVWRM EGAWSMSASH

Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.