IFT22 cDNA

Cat No.
ATGD0461

Size

QTY

List Price

10ug

USD 99


USD 0



Product Information

Product Type
cDNA
Antigen Species
Human
NCBI Accession No.
NP_073614.1
Alternative names
RABL5
RNA Reference Number
NM_022777.2
OMIM Number
Chromosome Location
7q22.1

Product Specification

Formulation
Lyophilized
Storage
Store the plasmid at -20C.
cDNA size
558bp
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
Vector description:
This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
General Description
IFT22 (Intraflagellar Transport 22) is a small GTPase-like component of the intraflagellar transport (IFT) complex B.

Data

  1. Nucleotide Sequence:
    ATGCTGAAAGCCAAGATCCTCTTCGTGGGGCCTTGCGAGAGTGGAAAAACTGTTTTGGCCAACTTTCTGACAGAATCTTCTGACATCACTGAATACAGCCCAACCCAAGGAGTGAGGATCCTAGAATTTGAGAACCCGCATGTTACCAGCAACAACAAAGGCACGGGCTGTGAATTCGAGCTATGGGACTGTGGTGGCGATGCTAAGTTTGAGTCCTGCTGGCCGGCCCTGATGAAGGATGCTCATGGAGTGGTGATCGTCTTCAATGCTGACATCCCAAGCCACCGGAAGGAAATGGAGATGTGGTATTCCTGCTTTGTCCAACAGCCGTCCTTACAGGACACACAGTGTATGCTAATTGCACACCACAAACCAGGCTCTGGAGATGATAAAGGAAGCCTGTCTTTGTCGCCACCCTTGAACAAGCTGAAGCTGGTGCACTCAAACCTGGAAGATGACCCTGAGGAGATCCGGATGGAATTCATAAAGTATTTAAAAAGCATAATCAACTCCATGTCTGAGAGCAGAGACAGGGAGGAGATGTCAATTATGACCTAG
  2. Translation Sequence:
    MLKAKILFVG PCESGKTVLA NFLTESSDIT EYSPTQGVRI LEFENPHVTS NNKGTGCEFE LWDCGGDAKF ESCWPALMKD AHGVVIVFNA DIPSHRKEME MWYSCFVQQP SLQDTQCMLI AHHKPGSGDD KGSLSLSPPL NKLKLVHSNL EDDPEEIRME FIKYLKSIIN SMSESRDREE MSIMT

Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.